The Role of Piwil4, an Argonaute Family Protein, in Breast Cancer

. 2016 May 13;291(20):10646-58.

doi: 10.1074/jbc.M116.723239. Epub 2016 Mar 8.

The Function of PIWIL4, an Argonaute Family Protein, in Breast Cancer

Affiliations

• PMID: 26957540
• PMCID: PMC4865913
• DOI: x.1074/jbc.M116.723239

Free PMC article

The Office of PIWIL4, an Argonaute Family Poly peptide, in Breast Cancer

Zifeng Wang  et al. J Biol Chem. 2016 .

Costless PMC article

Abstruse

P-chemical element-induced wimpy testis (PIWI) proteins bind to PIWI-interacting RNAs and play fundamental roles in the biogenesis and functions of PIWI-interacting RNAs. It has been reported that PIWI proteins are essential for stem jail cell self-renewal and germline development in various organisms and that they are ectopically expressed in multiple forms of cancer. Yet, the role of PIWI in cancer remains elusive. Hither nosotros report that one of the four PIWI proteins in humans, PIWIL4, is highly expressed in both chest cancer tissues and the cytoplasm of MDA-MB-231 cells derived from breast cancer. Reducing PIWIL4 expression drastically impairs the migration power of MDA-MB-231 cells, significantly increases their apoptosis, and mildly affects their proliferation. Our transcriptome and proteome analysis reveal that these functions are at least partially accomplished via the PIWIL4 regulation of TGF-β and FGF signaling pathways and MHC class II proteins. These findings advise that PIWIL4 may serve as a potential therapeutic target for breast cancer.

Keywords: Argonaute; TGF-β; cancer; metastasis; migration.

© 2016 by The American Club for Biochemistry and Molecular Biology, Inc.

Figures

Figure ane.

PIWIL4 is widely highly expressed in TNBCs. A–C, expression of PIWIL1 (A), PIWIL2 (B), and PIWIL4 (C) in vii breast cancer cell lines and a noncancerous breast jail cell line, MCF-10A. D–F, expression of PIWIL1 (D), PIWIL2 (E), and PIWIL4 (F) in 20 pairs of breast cancer samples (C) and their paired normal samples (Due north). *, p < 0.05; **, p < 0.01 compared with the controls.

FIGURE ii.

PIWIL4 expression is highly correlated with chest cancer fatality and afar metastasis fatality. A–C, clinical overall survival and afar metastasis-gratuitous and mail-progression survival of chest cancer patients with the superlative versus the lower two tertile (labeled loftier and low, respectively) expression levels of PIWIL1 (A), PIWIL2 (B), and PIWIL4 (C). The data resource was the KM-plotter database. P, log-rank p; HR, take a chance ratio.

FIGURE iii.

PIWIL4 is localized in the cytoplasm and exists in multiple isoforms in MDA-MB-231 cells. A, expression of PIWIL4 in the cytoplasm and nucleus of MDA-MB-231 cells, every bit indicated past subcellular fractionation and Western blotting analysis, in which Actin and TBP were used as cytoplasmic and nuclear markers, respectively. Con, command MDA-MB-231 cells transfected with an empty plasmid; OE, MDA-MB-231 cells with PIWIL4 overexpression via transfection. B, immunofluorescence staining of PIWIL4 and hDcp1a (a P body marker) in MDA-MB-231 cells. C, half-dozen PIWIL4 mRNA isoforms of PIWIL4 in MDA-MB-231 cells, with deletions, insertions, and stop codons indicated. PIWIL4 is the wild-type, total-length isoform. PL4L9 has a portion of intron inserted before exon 9. PL4L13 has a cytosine C deletion in the 566 site (red star). The insert sequence in PL4L13 is 5′-GTACTAAAAATATAGCAATGTGGGTGGGCTCCAAGGACTGTTCCTTCAGACCTCAAATCCACATGCTTATAGAAGACCACATAG-3′. The insert sequence in PL4L15 is 5′-GCCAAGAGCTGTTCCCAAAGGCCAAGCCCAAGGTTTGCACGAAGCTCCTCCAAGGAGTTCCAAACTTGAGATCACAGGACAAAGACTAGTCTGAAGTGTGATGGCTCCCTACTCCCAGCACCATGAAGCCAGAGTGACTTTTCACTCCATCCTCCCCAGTGAGCTTAAGTTCCCA-iii′. The lessons in other isoforms are self-axiomatic from the figure. D, four PIWIL4 protein isoforms corresponding to the six mRNA isoforms. AA, amino acids.

Figure 4.

PIWIL4 inhibits MDA-MB-231 cell apoptosis and promotes migration. A, diagram of the pSuper-shRNA knockdown system with three sense shRNA sequences of PIWIL4. PGK, phosphoglycerate kinase. B, the mRNA level and poly peptide level of MDA-MB-231 cells transfected with shPIWIL4–1, -2, and -3 and shCon (an empty vector control) for 48 h. C, growth curve of MDA-MB-231 cells with shPIWIL4–ane, -two, and -3 and shCon. OD, optical density. D, clone formation assay of MDA-MB-231 cells expressing shCon or shPIWIL4–1, -2, and -3. Colonies were counted after 10 days, indicating that PIWIL4 knockdown reduced the colony formation ability by up to ii-fold. E, protein levels of phosphorylated CHK2 and phosphorylated CDC2, p27, E-cadherin, N-cadherin, and broken caspase three in MDA-MB-231 cells expressing shCon and shPIWIL4. F, menstruum cytometry analysis of cell apoptosis using Annexin V and 7-amino-actinomycin D (7AAD) as early and late apoptotic markers, respectively. 1000, scratch assay indicating the wound healing results (i.e. migratory ability) of MDA-MB-231 cells transfected with shCon and shPIWIL4–ane, -2, and -iii. H, transwell assay of MDA-MB-231 cells expressing shCon or shPIWIL4–ane, -2, and -3, showing that PIWIL4 knockdown significantly hampered cell migration. *, p < 0.05; **, p < 0.01 compared with the controls.

Effigy 5.

PIWIL4 is essential for activation of TGF-β and FGF signaling in MDA-MB-231 cells. A, heat map of 732 differentially expressed mRNAs between MDA-MB-231 cells with and without shPIWIL4–3 treatment. Greenish labeled 0 indicates the lowest expression level, red labeled 4 indicates the highest expression level, and the alphabetize was an arbitrary unit of measurement. B, heat map of the 60 most differentially expressed mRNAs between MDA-MB-231 cells with and without shPIWIL4–3 treatment. C, Venn diagram of three different PIWIL4 knockdown samples and command MDA-MB-231 cells. The blue circumvolve (also appears in other colors because of the overlap with the green and tan circles) indicates 5397 proteins detected in MDA-MD-231 cells treated with shRNA vector only. The green circumvolve (which appears as night tan (207) and dark brown because of the overlap with the blueish and tan circles) indicates a total of 2571 proteins detected in all iii MDA-MB-231 shPIWIL4 samples. The tan circle (which as well appears in three other dissimilar colors because of the overlap with the bluish and dark-green circles) indicates 7094 proteins that appear in at least one of the three MDA-MB-231 shPIWIL4 samples. D, reactome and KEGG pathway analysis from of 207 up-regulated proteins by an online tool, with p < 0.0001, which showed that components of the translational machinery are significantly enriched. East, reactome pathway analysis of 1288 down-regulated proteins by an online tool, with p < 0.01, which showed that the TGF-β and FGF signaling pathways are significantly enriched. F, TGFβR1, TGFβR2, FGFR2, TGFβ1, and TGFβ3 mRNA levels in the three PIWIL4 knockdown samples are down-regulated in three PIWIL4 knockdown cells compared with the command. *, p < 0.05; **, p < 0.01. 1000, gene ontology analysis of 1495 differentially expressed proteins by an online tool, with p < 0.01.

FIGURE 6.

Analysis of piRNAs in MDA-MB-231 cells. A, pie chart illustrating the genomic source note of all mapped sequences. B, the size profile of the "others" group sequences. The 24- to 32-nt size range for putative piRNAs is shadowed in grayness. The abundance was normalized to 1 meg in each sample for comparison. C, donut display of known piRNAs (known) versus putative piRNAs (new) in the 24- to 32-nt population from the "others" group. D, nucleotide preference profile of 24- to 32-nt putative RNAs from position i to position 24. East, annotation of putative RNAs from the "others" group. nc, noncoding; TE, transposons. F, scatter plot of the ratio of all newly identified known and putative RNAs that had at least 10 mappable reads in either normal or PiwiL4 knockdown MDA-MB-231 cells. Red dashed lines correspond to log2 value 1, −one.

Effigy seven.

A proposed regulation machinery of PIWIL4 in the breast cancer jail cell line MDA-MB-231. PIWIL4 could promote breast cancer prison cell survival, proliferation, epithelial-to-mesenchymal transition (EMT), and migration by activation of the TGF-β, FGF, and MAPK/ERK signaling pathways. Meanwhile, PIWIL4 might repress MHC class 2, which helps cancer cells avoid immune recognition and reaction.

Like articles

• The role of 17β‑estradiol‑induced upregulation of Piwi‑like 4 in modulating gene expression and motility in breast cancer cells.

  Heng ZSL, Lee JY, Subhramanyam CS, Wang C, Thanga LZ, Hu Q. Heng ZSL, et al. Oncol Rep. 2018 Nov;forty(five):2525-2535. doi: 10.3892/or.2018.6676. Epub 2018 Aug 31. Oncol Rep. 2018. PMID: 30226541 Free PMC article.

• Piwi-interacting RNAs and PIWI genes as novel prognostic markers for breast cancer.

  Krishnan P, Ghosh Due south, Graham K, Mackey JR, Kovalchuk O, Damaraju S. Krishnan P, et al. Oncotarget. 2016 Jun 21;seven(25):37944-37956. doi: 10.18632/oncotarget.9272. Oncotarget. 2016. PMID: 27177224 Gratuitous PMC article.

• Overexpression of hiwi promotes growth of human being breast cancer cells.

  Wang DW, Wang ZH, Wang LL, Song Y, Zhang GZ. Wang DW, et al. Asian Pac J Cancer Prev. 2014;15(18):7553-8. doi: x.7314/apjcp.2014.xv.xviii.7553. Asian Pac J Cancer Prev. 2014. PMID: 25292027

• PIWI Proteins and PIWI-Interacting RNA: Emerging Roles in Cancer.

  Han YN, Li Y, Xia SQ, Zhang YY, Zheng JH, Li West. Han YN, et al. Cell Physiol Biochem. 2017;44(1):one-20. doi: 10.1159/000484541. Epub 2017 Nov 3. Cell Physiol Biochem. 2017. PMID: 29130960 Review.

• A slice of the pi(e): The diverse roles of animal piRNAs and their PIWI partners.

  Lim RS, Kai T. Lim RS, et al. Semin Cell Dev Biol. 2015 Dec;47-48:17-31. doi: 10.1016/j.semcdb.2015.10.025. Epub 2015 November 12. Semin Cell Dev Biol. 2015. PMID: 26582251 Review.

Cited by 25 articles

• Circulating non-coding RNAs as a diagnostic and management biomarker for breast cancer: electric current insights.

  Hosseinalizadeh H, Mahmoodpour Yard, Ebrahimi A. Hosseinalizadeh H, et al. Mol Biol Rep. 2022 January;49(one):705-715. doi: 10.1007/s11033-021-06847-three. Epub 2021 Oct 22. Mol Biol Rep. 2022. PMID: 34677714 Review.

• Piwi-Interacting RNAs: A New Class of Regulator in Human Breast Cancer.

  Qian L, Xie H, Zhang Fifty, Zhao Q, Lü J, Yu Z. Qian 50, et al. Front Oncol. 2021 Jul half-dozen;11:695077. doi: x.3389/fonc.2021.695077. eCollection 2021. Front Oncol. 2021. PMID: 34295823 Free PMC article. Review.

• A Cluster-Based Approach for the Discovery of Copy Number Variations From Next-Generation Sequencing Information.

  Liu K, Zhang J. Liu Chiliad, et al. Front Genet. 2021 Jun 28;12:699510. doi: ten.3389/fgene.2021.699510. eCollection 2021. Front Genet. 2021. PMID: 34262604 Free PMC article.

• Piwil1 Regulates Glioma Stem Cell Maintenance and Glioblastoma Progression.

  Huang H, Yu 10, Han Ten, Hao J, Zhao J, Bebek G, Bao Southward, Prayson RA, Khalil AM, Jankowsky Due east, Yu JS. Huang H, et al. Cell Rep. 2021 January 5;34(1):108522. doi: ten.1016/j.celrep.2020.108522. Cell Rep. 2021. PMID: 33406417 Free PMC commodity.

• Exosomal noncoding RNAs in cholangiocarcinoma: Laboratory noise or hope?

  Laschos K, Lampropoulou DI, Aravantinos Chiliad, Piperis M, Filippou D, Theodoropoulos G, Gazouli Yard. Laschos K, et al. Globe J Gastrointest Surg. 2020 Oct 27;12(10):407-424. doi: ten.4240/wjgs.v12.i10.407. World J Gastrointest Surg. 2020. PMID: 33194090 Free PMC commodity. Review.

Publication types

MeSH terms

Substances

LinkOut - more than resource

• Full Text Sources

  • Elsevier Science
  • Europe PubMed Central
  • PubMed Primal

• Other Literature Sources

  • Kinesthesia Opinions
  • The Lens - Patent Citations
  • scite Smart Citations

• Medical

  • Genetic Alliance
  • MedlinePlus Wellness Information

• Research Materials

  • NCI CPTC Antibody Characterization Plan

• Miscellaneous

  • NCI CPTAC Analysis Portal

barnettetivere.blogspot.com

Source: https://pubmed.ncbi.nlm.nih.gov/26957540/

Share this post